rocE [2018-02-11T09:32:16.000Z]

amino acid permease

Locus: BSU40330

Isoelectric point: 8.53

Molecular weight: 51.47 kDa

Protein length: 467 aa

Gene length: 1401 bp

Function: arginine, ornithine and citrulline uptake

Product: amino acid permease

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → APC superfamily
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of arginine
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of arginine/ ornithine
• Groups of genes → Membrane proteins

Gene

Coordinates: 4,142,675 → 4,144,078

The protein

Paralogous protein(s)

• AapA, GabP, HutM, RocC, YbgF, YbxG, YdgF, YtnA, YvbW

Structure

• 3LRB (from E. coli, 25% identity) PubMed

Localization

• cell membrane (according to Swiss-Prot), membrane associated PubMed

Expression and Regulation

Operons

• Genes: rocD-rocE-rocF
  Description: PubMed

  Sigma factors

  • SigL: sigma factor, PubMed, in SigL regulon

  Regulatory mechanism

  • Spo0A: repression, PubMed, in Spo0A regulon
  • AhrC: activation, PubMed, in AhrC regulon
  • CodY: repression, PubMed, in CodY regulon
  • RocR: activation, PubMed, in RocR regulon

  Regulation

  • induced by arginine (RocR, AhrC) PubMed

  Additional information

  • expression of the rocD-rocE-rocF operon is increased upon depletion of nusA (resulting from increased ahrC expression) Reference

Biological materials

Mutant

• BKE40330 (ΔrocE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACATTCTGCACCCCTTCAG, downstream forward: _UP4_TAAAAACGTTGTCCGCAAGT
• BKK40330 (ΔrocE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACATTCTGCACCCCTTCAG, downstream forward: _UP4_TAAAAACGTTGTCCGCAAGT

References

Loading